Stem-loop sequence nta-MIR395a

AccessionMI0021395 (change log)
DescriptionNicotiana tabacum miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention nta-MIR395a
(46 sentences)

   --uucc   u         ug u       uugggacuugaaaaaugcccuuuaaa 
5'       ccu gaguucucc  a cacuuca                          u
         ||| |||||||||  | |||||||                          u
3'       gga cucaagggg  u gugaagu                          g
   caccga   u         gu u       cauccguaauuauuaauuaugguaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR395a

Accession MIMAT0024705

83 - 


 - 103

Get sequence
Evidence experimental; Illumina [1]


PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).