Stem-loop sequence nta-MIR394

AccessionMI0021394 (change log)
DescriptionNicotiana tabacum miR394 stem-loop
Gene family MIPF0000100; MIR394
Literature search

1 open access papers mention nta-MIR394
(1 sentences)

Stem-loop
   --      cau            -   a     --    cu  cuc 
5'   uagagc   uuuggcauucug ucc ccucc  auug  ag   c
     ||||||   |||||||||||| ||| |||||  ||||  ||    
3'   gucucg   aaaccgugagac ggg ggagg  uaac  uc   a
   ac      auc            c   -     ag    uu  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR394

Accession MIMAT0024704
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).