Stem-loop sequence nta-MIR390b

AccessionMI0021392 (change log)
DescriptionNicotiana tabacum miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

2 open access papers mention nta-MIR390b
(4 sentences)

Stem-loop
   --    u    a          g         c       aa  ---uu     c 
5'   agaa cugu aagcucagga ggauagcgc auggaug  ua     aguaa a
     |||| |||| |||||||||| ||||||||| |||||||  ||     ||||| c
3'   ucuu gaua uuugaguccu ccuaucgcg ugucuac  au     ucguu u
   cu    c    c          a         a       cg  uuugu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR390b

Accession MIMAT0024702
Sequence

11 - 

aagcucaggagggauagcgcc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).