Stem-loop sequence nta-MIR319a

AccessionMI0021389 (change log)
DescriptionNicotiana tabacum miR319a stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention nta-MIR319a
(8 sentences)

Stem-loop
   aguua  -    --     uu          ca       gg ga    gu        --  g   ac        c  aa         uagaua u g 
5'      ug aaga  gagcu  cuucggucca  cauagga  u  uaag  ucaauuug  cu ccg  ucauucau ca  ugcugaggu      g c a
        || ||||  |||||  ||||||||||  |||||||  |  ||||  ||||||||  || |||  |||||||| ||  |||||||||      | |  
3'      ac uucu  cucga  gaagucaggu  guguccu  g  auuc  aguugaac  ga ggc  aguaagua gu  augacucca      c g a
   --cua  a    cc     gg          uc       uu -a    ug        au  g   ga        a  cg         ------ - a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR319a

Accession MIMAT0024699
Sequence

160 - 

uuggacugaagggagcucccu

 - 180

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).