Stem-loop sequence nta-MIR172j

AccessionMI0021388 (change log)
DescriptionNicotiana tabacum miR172j stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention nta-MIR172j
(20 sentences)

Stem-loop
   --      g      u              a  aacu    ----       ---a    cuacauacggguuaggucgaacccaguauauuugcucaaaauaguguauuuaucuuaagaaau 
5'   guuuga gaugca caucaucaagauuc ca    ugaa    aggagaa    ggau                                                               u
     |||||| |||||| |||||||||||||| ||    ||||    |||||||    ||||                                                                
3'   caaacu cuacgu guaguaguucuaag gu    acuu    uccucuu    ccua                                                               u
   ua      a      c              g  --au    uaaa       agaa    aaaucuuguugcuggaguuuacauuauuuacuaaaguuuuaaauuauauacauguauaaauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR172j

Accession MIMAT0024698
Sequence

207 - 

ggaaucuugaugaugcugcau

 - 227

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).