Stem-loop sequence nta-MIR172f

AccessionMI0021384 (change log)
DescriptionNicotiana tabacum miR172f stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention nta-MIR172f
(26 sentences)

Stem-loop
   -   gaag   a                     a    ua       accugauuuaucauuaugccauuggaacgauacacagauaauuagca 
5'  ucu    gug gaaucuugaugaugcugcauc gcaa  aacgacu                                               u
    |||    ||| ||||||||||||||||||||| ||||  |||||||                                               a
3'  gga    uac cuuagaacuacuacgaugugg cguu  uugcuga                                               a
   c   aaag   a                     g    ug       cauaguuaacuugguaugguacaugggcaccguaagaacguguacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR172f

Accession MIMAT0024694
Sequence

11 - 

agaaucuugaugaugcugcau

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).