Stem-loop sequence nta-MIR172e

AccessionMI0021383 (change log)
DescriptionNicotiana tabacum miR172e stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention nta-MIR172e
(21 sentences)

Stem-loop
   guuugcagauguagcaucaucaagauucacauaaaaaacgcauggugaugagcugaugaaaugacauuaauggccaaggcagcuuucugaag   a                     a    ua       accugauuuaucauuaugccauuggaacgauacacagauaauuagca 
5'                                                                                             gug gaaucuugaugaugcugcauc gcaa  aacgacu                                               u
                                                                                               ||| ||||||||||||||||||||| ||||  |||||||                                               a
3'                                                                                             uac cuuagaacuacuacgaugugg cguu  uugcuga                                               a
   ----------aauaacgacuacgucguaguaguucuaagaguggaaguuuuucgguaccgagaauuaauuaaaguaaaguggaacggaaaag   a                     g    ug       cauaguuaacuugguaugguacaugggcaccguaagaacguguacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR172e

Accession MIMAT0024693
Sequence

320 - 

agaaucuugaugaugcugcau

 - 340

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).