Stem-loop sequence nta-MIR172d

AccessionMI0021382 (change log)
DescriptionNicotiana tabacum miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention nta-MIR172d
(20 sentences)

Stem-loop
   --gu    a                     acauaaaaaacgcauggugaugagcugaugaaa 
5'     uugc gauguagcaucaucaagauuc                                 u
       |||| |||||||||||||||||||||                                  
3'     aacg cuacgucguaguaguucuaag                                 g
   aaau    a                     aguggaagucuuucgacggaaccgguaauuaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR172d

Accession MIMAT0024692
Sequence

96 - 

agaaucuugaugaugcugcau

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).