Stem-loop sequence nta-MIR172c

AccessionMI0021381 (change log)
DescriptionNicotiana tabacum miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention nta-MIR172c
(20 sentences)

Stem-loop
   -gu    g                     a   --g     c  ----     g  gaaau 
5'    uugc gauguagcaucaucaagauuc cau   caaaa gc    auggu au     g
      |||| ||||||||||||||||||||| |||   ||||| ||    ||||| ||      
3'    aacg cuacgucguaguaguucuaag gug   guuuu cg    uaccg ua     a
   aau    a                     a   gaa     u  acgg     g  auuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR172c

Accession MIMAT0024691
Sequence

88 - 

agaaucuugaugaugcugcau

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).