Stem-loop sequence nta-MIR172b

AccessionMI0021380 (change log)
DescriptionNicotiana tabacum miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention nta-MIR172b
(20 sentences)

Stem-loop
   --ac    a c             a     a    -------     cau u  -a     aaauaug 
5'     uugc g ugcagcauuauca gauuc caua       gaaau   g gg  gcaga       u
       |||| | ||||||||||||| ||||| ||||       |||||   | ||  |||||       u
3'     aacg c acgucguaguagu cuaag guau       uuuug   c cc  cgucu       u
   aaua    a u             a     a    aaguuuu     aau c  ac     aaaaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR172b

Accession MIMAT0024690
Sequence

99 - 

agaaucaugaugaugcugcau

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).