Stem-loop sequence nta-MIR172a

AccessionMI0021379 (change log)
DescriptionNicotiana tabacum miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention nta-MIR172a
(20 sentences)

Stem-loop
   --uu    aga         u         a     agua  uu   u     u  auugu     a  a   uu 
5'     uugc   ugcagcauc ucaagauuc cauau    ua  uua ggagu ca     gggag aa aaa  a
       ||||   ||||||||| ||||||||| |||||    ||  ||| ||||| ||     ||||| || |||   
3'     aacg   acgucguag aguucuaag guaua    au  aau ccucg gu     cccuc uu uuu  a
   aagu    acg         u         a     ----  uu   u     -  ---au     g  c   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR172a

Accession MIMAT0024689
Sequence

112 - 

agaaucuugaugaugcugcag

 - 132

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).