Stem-loop sequence nta-MIR171b

AccessionMI0021377 (change log)
DescriptionNicotiana tabacum miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention nta-MIR171b
(8 sentences)

Stem-loop
   ---uaa      c          a         c  a  -   -g      uuu 
5'       aggaag gauguuggug gguucaauc ga ga cgu  uuuacg   u
         |||||| |||||||||| ||||||||| || || |||  ||||||   g
3'       uccuuc cuauaaccgc ccgaguuag cu cu gca  aaaugc   u
   uauaua      a          g         a  -  a   aa      uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR171b

Accession MIMAT0024687
Sequence

75 - 

uugagccgcgccaauaucacu

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).