Stem-loop sequence nta-MIR171a

AccessionMI0021376 (change log)
DescriptionNicotiana tabacum miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

5 open access papers mention nta-MIR171a
(13 sentences)

Stem-loop
   --a      a        ug         g      c  uac    ca 
5'    uacacg gauauugg  cgguucaau agaaag ag   ucga  a
      |||||| ||||||||  ||||||||| |||||| ||   ||||   
3'    augugc cuauaacc  gccgaguua uuuuuc uc   aguu  a
   acg      a        gu         g      a  -uc    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR171a

Accession MIMAT0024686
Sequence

11 - 

uauuggugcgguucaaugaga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).