Stem-loop sequence nta-MIR169s

AccessionMI0021374 (change log)
DescriptionNicotiana tabacum miR169s stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

4 open access papers mention nta-MIR169s
(15 sentences)

Stem-loop
   ---    uua                    a  u          -   gc        -      g  a    -ca   --a        ---    aa  ca    uu 
5'    caac   ucggcaggucguccuuggcu ca uucacucucu ucu  ucauguaa ggcuuu ua gacg   uau   uaguucga   ggug  gu  guga  g
      ||||   |||||||||||||||||||| || |||||||||| |||  |||||||| |||||| || ||||   |||   ||||||||   ||||  ||  ||||  c
3'    guug   ggccguucaguaggaaccga gu aggugaggga gga  aguacguu cugaga au cugu   aua   guuaaguu   cuac  ua  cacu  g
   gau    uag                    c  u          u   ga        a      g  -    uua   cuc        gac    ac  aa    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR169s

Accession MIMAT0024684
Sequence

179 - 

cagccaaggaugacuugccgg

 - 199

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).