Stem-loop sequence nta-MIR169q

AccessionMI0021372 (change log)
DescriptionNicotiana tabacum miR169q stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

4 open access papers mention nta-MIR169q
(15 sentences)

Stem-loop
   ---       u  c                    ---ga       gucaa       a   auc gu     g         a  u       u  u  -gc        -      aua     uauauauaauu   --ggu    uca      guu 
5'    gagugga ug agccaaggaugacuugccgg     uguugua     ugcaacg cuu   g  agguc uccuuggcu ca uuuacuc cu cu   ucauguaa ggcucu   agaua           cga     gaag   guaauu   u
      ||||||| || ||||||||||||||||||||     |||||||     ||||||| |||   |  ||||| ||||||||| || ||||||| || ||   |||||||| ||||||   |||||           |||     ||||   ||||||    
3'    cucacuu ac ucgguuccugcuggacggcu     gcaacgu     acguugu gaa   c  uucag aggaaccga gu aagugag ga ga   aguacguu cugaga   ucugu           guu     uuuc   cauuaa   c
   ucu       u  a                    auuca       aaccg       a   --- ug     -         c  u       c  u  aaa        a      -ga     --uuaauacuc   aauuu    cua      aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR169q

Accession MIMAT0024682
Sequence

11 - 

cagccaaggaugacuugccgg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).