Stem-loop sequence nta-MIR169o

AccessionMI0021370 (change log)
DescriptionNicotiana tabacum miR169o stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

4 open access papers mention nta-MIR169o
(15 sentences)

   a     uua                    a  u          -   gc        -      guaa    c  auau  u    ggugaagucaguaauugcgu 
5'  acgac   ucggcaggucguccuuggcu ca uucacucuuu ucu  ucauguaa ggcucu    gacg au    ag ucga                    u
    |||||   |||||||||||||||||||| || |||||||||| |||  |||||||| ||||||    |||| ||    || ||||                    u
3'  uguug   agccguucaguaggaaccga gu aggugagaga gga  aguacguu cugaga    cugu ua    uc aguu                    c
   a     uag                    c  u          u   ga        a      -aac    u  --au  u    aaguugaccuauacuaaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR169o

Accession MIMAT0024680

181 - 


 - 201

Get sequence
Evidence experimental; Illumina [1]


PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).