Stem-loop sequence nta-MIR169j

AccessionMI0021366 (change log)
DescriptionNicotiana tabacum miR169j stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

4 open access papers mention nta-MIR169j
(15 sentences)

Stem-loop
   ----      uu  c                    gau     a  u 
5'     aguaga  ug agccaaggaugacuugccga   guugu gc a
       ||||||  || ||||||||||||||||||||   ||||| ||  
3'     ucauuu  ac ucgguuccugcuggacggcu   cagca cg a
   cucu      -u  a                    auu     a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR169j

Accession MIMAT0024676
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).