Stem-loop sequence nta-MIR169h

AccessionMI0021364 (change log)
DescriptionNicotiana tabacum miR169h stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

4 open access papers mention nta-MIR169h
(15 sentences)

Stem-loop
   ---    g  u  c                 c  gau     a  u 
5'    gagu ga ug agccaaggaugacuugc ga   guugu gc a
      |||| || || ||||||||||||||||| ||   ||||| ||  
3'    cucg uu ac ucgguuccugcuggacg cu   cagca cg a
   uuu    a  u  a                 u  auu     a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR169h

Accession MIMAT0024674
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).