Stem-loop sequence nta-MIR168d

AccessionMI0021355 (change log)
DescriptionNicotiana tabacum miR168d stem-loop
Gene family MIPF0000081; MIR168
Literature search

3 open access papers mention nta-MIR168d
(3 sentences)

Stem-loop
   --    u        c          u       u    -c    g     cuguccgcgccggaaucggcgccuuucauugauauuuuguuuauauguaucgauauuuagagagcucucauuaggacuuauuuguuaguaaaauuuuguuguugaaauuaacuugauauauguauaga 
5'   gguc cuaauucg uuggugcagg cgggaac gacu  gccg ugacg                                                                                                                                u
     |||| |||||||| |||||||||| ||||||| ||||  |||| |||||                                                                                                                                a
3'   ccag gguuaagu aacuacguuc gcccuug uuga  cggu gcugc                                                                                                                                a
   cg    u        c          c       u    au    a     uccgcgugaaaguaaguauugauuagauaauuuuuuuaacuugagagauguauagguaaugaauugguuggcacccauuugugagagauguauagauaaugaauugguugguccccauuugugagaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR168d

Accession MIMAT0024665
Sequence

11 - 

ucgcuuggugcaggucgggaa

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).