Stem-loop sequence nta-MIR168c

AccessionMI0021354 (change log)
DescriptionNicotiana tabacum miR168c stem-loop
Gene family MIPF0000081; MIR168
Literature search

3 open access papers mention nta-MIR168c
(3 sentences)

Stem-loop
   --       c     c          u        gccucgccggcgacaaugaugucagcugacgg 
5'   ggucucu auucg uuggugcagg cgggaccu                                u
     ||||||| ||||| |||||||||| ||||||||                                g
3'   ucagagg uaagu aacuacguuc gcccuggg                                a
   cg       c     c          c        uuugucguacauauaaauagccaugcggcggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR168c

Accession MIMAT0024664
Sequence

11 - 

ucgcuuggugcaggucgggac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).