Stem-loop sequence nta-MIR167e

AccessionMI0021351 (change log)
DescriptionNicotiana tabacum miR167e stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

4 open access papers mention nta-MIR167e
(9 sentences)

Stem-loop
       ---g   u   a     ca         aaa       aguu    
5' acua    uag uga gcugc  gcaugaucu   cuuuucu    gcu 
   ||||    ||| ||| |||||  |||||||||   |||||||    || c
3' uggu    guc acu cgacg  uguacuaga   gaaagga    ugc 
       aguu   c   a     -a         cua       --gu    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR167e

Accession MIMAT0024661
Sequence

10 - 

ugaagcugccagcaugaucua

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).