Stem-loop sequence nta-MIR167d

AccessionMI0021350 (change log)
DescriptionNicotiana tabacum miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

4 open access papers mention nta-MIR167d
(10 sentences)

Stem-loop
   -c    u a u           g          a   a    uuguaau 
5'   acua c g ugaagcugcca caugaucuaa cuu ccuc       a
     |||| | | ||||||||||| |||||||||| ||| ||||       a
3'   ugau g c acuucgauggu guacuagauu gaa ggag       u
   gu    u c c           -          a   g    uuugaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR167d

Accession MIMAT0024660
Sequence

11 - 

ugaagcugccagcaugaucua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).