Stem-loop sequence nta-MIR167b

AccessionMI0021348 (change log)
DescriptionNicotiana tabacum miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

4 open access papers mention nta-MIR167b
(9 sentences)

Stem-loop
   --uu    a            c  c          ac    a  gu    uucuuu     aua           g   -      aauc   aggu    ug -----g   ug    uag 
5'     ugag gguugaagcugc ag augaucuggu  gaac aa  ccau      gcuau   uauauuuucuu caa aagaau    uug    guuu  g      uuu  aauu   c
       |||| |||||||||||| || ||||||||||  |||| ||  ||||      |||||   ||||||||||| ||| ||||||    |||    ||||  |      |||  ||||   u
3'     acuc cuaacuucgacg uc uacuggacua  cuug uu  ggua      cgaug   auauaagagaa guu uuuuug    aac    uaag  u      aag  uuag   a
   cacc    a            a  -          -c    g  ug    --cuuu     --g           a   a      ---a   guuu    gu aaagaa   gu    uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR167b

Accession MIMAT0024658
Sequence

11 - 

ugaagcugccagcaugaucugg

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).