Stem-loop sequence nta-MIR166g

AccessionMI0021345 (change log)
DescriptionNicotiana tabacum miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

3 open access papers mention nta-MIR166g
(5 sentences)

   -uuu   a   a     uu          u  ccaaucuguaaacaguaauuagcu 
5'     guu agg gaaug  gucugguucg ga                        a
       ||| ||| |||||  |||||||||| ||                        a
3'     caa ucc cuuac  cggaccaggc cu                        c
   aacu   c   c     uu          u  aguaaguucacuacuuacaacugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR166g

Accession MIMAT0024655

85 - 


 - 105

Get sequence
Evidence experimental; Illumina [1]


PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).