Stem-loop sequence nta-MIR166f

AccessionMI0021344 (change log)
DescriptionNicotiana tabacum miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

3 open access papers mention nta-MIR166f
(5 sentences)

Stem-loop
   --agcu   a        uu      cu   a c         cucuugauuuaaccuaguucaagaaguaguauga 
5'       uug ggggaaug  gucugg  cga g cacuaucuc                                  g
         ||| ||||||||  ||||||  ||| | |||||||||                                  u
3'       aac ccccuuac  cggacc  gcu c gugauagag                                  a
   agguuu   c        uu      ag   g u         aguaauaacaaacaaguauguugaaacuguuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR166f

Accession MIMAT0024654
Sequence

125 - 

ucggaccaggcuucauucccc

 - 145

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).