Stem-loop sequence nta-MIR166e

AccessionMI0021343 (change log)
DescriptionNicotiana tabacum miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

3 open access papers mention nta-MIR166e
(5 sentences)

Stem-loop
   --u      a        uu      cu   g u   c    --a         g    acuuuaugcuuauuugaacauaaagauuagu 
5'    caguug ggggaaug  gucugg  cga g cac aacu   gauccauaa cucc                               u
      |||||| ||||||||  ||||||  ||| | ||| ||||   ||||||||| ||||                               u
3'    guuaac ccccuuac  cggacc  gcu u gug uuga   cuagguauu gggg                               u
   auu      c        uu      ag   g u   a    gua         -    aaaaguauauuaguugcuuagaaauauaaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR166e

Accession MIMAT0024653
Sequence

148 - 

ucggaccaggcuucauucccc

 - 168

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).