Stem-loop sequence nta-MIR166a

AccessionMI0021339 (change log)
DescriptionNicotiana tabacum miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

3 open access papers mention nta-MIR166a
(10 sentences)

Stem-loop
   -u      a        uu      cu   g u      -  -       auuauuugaacucucuuucccuuuuugagaugucaucuccau 
5'   guuuug ggggaaug  gucugg  cga g cacuaa cu ugaucca                                          u
     |||||| ||||||||  ||||||  ||| | |||||| || |||||||                                          a
3'   uaaaac ccccuuac  cggacc  gcu c gugauu gg acuaggu                                          a
   uu      c        uu      ag   g u      u  u       acuagggauuacgguuaguucuugauaacuagauaaacaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR166a

Accession MIMAT0024649
Sequence

155 - 

ucggaccaggcuucauucccc

 - 175

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).