Stem-loop sequence nta-MIR164c

AccessionMI0021338 (change log)
DescriptionNicotiana tabacum miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

2 open access papers mention nta-MIR164c
(6 sentences)

Stem-loop
   --uuau            a     -        u     a     uaacu 
5'       uuaagcuggaga gcagg gcacaugc aaauu cuugg     u
         |||||||||||| ||||| |||||||| ||||| |||||     u
3'       aauucgaccucu cguuc cguguacg uuuaa gaacu     g
   ccucuu            -     u        u     -     uucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR164c

Accession MIMAT0024648
Sequence

11 - 

uggagaagcagggcacaugcu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).