Stem-loop sequence nta-MIR162b

AccessionMI0021335 (change log)
DescriptionNicotiana tabacum miR162b stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

1 open access papers mention nta-MIR162b
(7 sentences)

Stem-loop
   --uug   a a     g    c    c       u      ugaa   a 
5'      agg c cugga gcag gguu aucgauc guuccc    cgc a
        ||| | ||||| |||| |||| ||||||| ||||||    |||  
3'      uuc g gaccu cguc ccaa uagcugg uaaggg    gcg c
   ccaaa   - c     a    u    a       c      --uc   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR162b

Accession MIMAT0024645
Sequence

65 - 

ucgauaaaccucugcauccag

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).