Stem-loop sequence nta-MIR160c

AccessionMI0021332 (change log)
DescriptionNicotiana tabacum miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

4 open access papers mention nta-MIR160c
(9 sentences)

Stem-loop
   ---aacu   a     c       c          a    -u   -      ------ g 
5'        ugg ugugc uggcucc uguaugccac cacu  uca ccaauc      c c
          ||| ||||| ||||||| |||||||||| ||||  ||| ||||||      |  
3'        acc auacg accgagg gcgugcggug guga  agu gguuag      g g
   auauuac   -     a       a          g    cu   c      uuucuu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR160c

Accession MIMAT0024642
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).