Stem-loop sequence nta-MIR160a

AccessionMI0021330 (change log)
DescriptionNicotiana tabacum miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

5 open access papers mention nta-MIR160a
(11 sentences)

Stem-loop
   a    g ---      c       cu          ug -a ag    u   a 
5'  auau c   auaugc uggcucc  guaugccauu  c  g  cuca cgg a
    |||| |   |||||| |||||||  ||||||||||  |  |  |||| |||  
3'  uaua g   uauacg accgagg  uaugcgguaa  g  c  gggu gcc u
   -    g ccc      a       ag          gu cc cu    u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR160a

Accession MIMAT0024640
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).