Stem-loop sequence nta-MIR159

AccessionMI0021329 (change log)
DescriptionNicotiana tabacum miR159 stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention nta-MIR159
(19 sentences)

Stem-loop
   --uu    a            ga       -c  a         ---a     gauu     g     c    g uu  u   c        uua 
5'     ugag guggagcuccuu  aguccaa  ag ggaucuaac    gguaa    gagcu cugac uaug a  cc cag ccuaucua   u
       |||| ||||||||||||  |||||||  || |||||||||    |||||    ||||| ||||| |||| |  || ||| ||||||||   u
3'     acuu caucucgaggga  uuagguu  uc ccuagguug    ccguu    uucga gacug auac u  gg guu ggauaggu   u
   guuu    a            ag       uu  -         aauc     --ac     g     u    g ug  u   u        uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR159

Accession MIMAT0024639
Sequence

154 - 

uuuggauugaagggagcucua

 - 174

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).