Stem-loop sequence nta-MIR156j

AccessionMI0021328
DescriptionNicotiana tabacum miR156j stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ---ugacaau  u         -           u     --   u     -aa  aaau 
5'           ug ugacagaag auagagagcac aauga  uga augcu   gu    g
             || ||||||||| ||||||||||| |||||  ||| |||||   ||     
3'           ac acugucuuc uaucucucgug uuacu  acu uacga   cg    u
   accggcuucc  u         g           u     ua   c     aaa  ggga 
Get sequence
Deep sequencing
1189 reads, 1.98e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

Mature sequence nta-miR156j

Accession MIMAT0024638
Sequence

11 - 

ugacagaagauagagagcac

 - 30

Get sequence
Deep sequencing68 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).