Stem-loop sequence nta-MIR156i

AccessionMI0021327
DescriptionNicotiana tabacum miR156i stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ----   uaau  u         -           u     --   u     aauuaaa    u 
5'     uga    ug ugacagaag auagagagcac gauga  uga augcu       uuug g
       |||    || ||||||||| ||||||||||| |||||  ||| |||||       |||| c
3'     acu    ac acugucuuc uaucucucgug uuacu  acu uacga       aaac a
   accg   -ucc  u         g           u     ua   c     -------    g 
Get sequence
Deep sequencing
63829 reads, 1.05e+05 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

Mature sequence nta-miR156i

Accession MIMAT0024637
Sequence

11 - 

ugacagaagauagagagcac

 - 30

Get sequence
Deep sequencing63050 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).