Stem-loop sequence nta-MIR156h

AccessionMI0021326
DescriptionNicotiana tabacum miR156h stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ---- ga    cugu           -            u   ga    a   ua uu g 
5'     g  gaug    ugacagaagau agagagcacaga gau  uaag ugc  a  g a
       |  ||||    ||||||||||| |||||||||||| |||  |||| |||  |  |  
3'     c  cuac    acugucuucug ucucucguguuu cua  auuc acg  u  c a
   ccga uc    ---u           a            c   --    c   uc uu g 
Get sequence
Deep sequencing
15037 reads, 2.72e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

Mature sequence nta-miR156h

Accession MIMAT0024636
Sequence

12 - 

ugacagaagauagagagcac

 - 31

Get sequence
Deep sequencing10110 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).