Stem-loop sequence nta-MIR156g

AccessionMI0021325 (change log)
DescriptionNicotiana tabacum miR156g stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   --     au  u    a    -                 ugaucaugcugcuaaaucugggauuggagagggcac 
5'   gugag  ug ugac gaag auagagagcacagauga                                    u
     |||||  || |||| |||| |||||||||||||||||                                     
3'   cacuu  ac acug cuuc uaucucucguguuuacu                                    g
   gc     cc  u    c    g                 uaacucuacgaaaaaaaaaaacgucaaauuaacuaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR156g

Accession MIMAT0024635
Sequence

11 - 

ugacagaagauagagagcac

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).