Stem-loop sequence nta-MIR156f

AccessionMI0021324
DescriptionNicotiana tabacum miR156f stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   --uu    ga         -     a       a      guu   uua      a  u 
5'     aaag  ggugacaga agaga ugagcac cauggu   uuc   caugag ua a
       ||||  ||||||||| ||||| ||||||| ||||||   |||   |||||| ||  
3'     uuuc  ccacugucu ucucu acucgug guauca   aag   guacuu au u
   uuuc    ac         a     c       c      ---   uuc      -  a 
Get sequence
Deep sequencing
499 reads, 918 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence nta-miR156f

Accession MIMAT0024634
Sequence

11 - 

ugacagaagagaaugagcac

 - 30

Get sequence
Deep sequencing464 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).