Stem-loop sequence nta-MIR156e

AccessionMI0021323
DescriptionNicotiana tabacum miR156e stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   --uaaa   a         -    -         a      auu   uu       
5'       ggg ggugacaga agag agugagcac cauggu   uuc  gcauau 
         ||| ||||||||| |||| ||||||||| ||||||   |||  ||||| g
3'       ccc ccacugucu ucuc ucacucgug guaucg   aag  cguaua 
   ucacca   c         a    g         c      ---   uu       
Get sequence
Deep sequencing
21388 reads, 3.61e+04 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence nta-miR156e

Accession MIMAT0024633
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Deep sequencing21230 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).