Stem-loop sequence nta-MIR156d

AccessionMI0021322 (change log)
DescriptionNicotiana tabacum miR156d stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ---aaaa   a         -             ag     guu   uu    ugaua 
5'        ggg ggugacaga agagagugagcac  auggu   uuc  gcau     u
          ||| ||||||||| |||||||||||||  |||||   |||  ||||      
3'        ccc ccacugucu ucucucacucgug  uaucg   aag  cgua     a
   cucacca   -         a             cg     ---   uu    uaugu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nta-miR156d

Accession MIMAT0024632
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).