Stem-loop sequence nta-MIR156c

AccessionMI0021321
DescriptionNicotiana tabacum miR156c stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ---   auca   c      -      -             ---    auu        
5'    aga    aga ugacag aagaga gugagcacacgca   ggca   guauaga 
      |||    ||| |||||| |||||| |||||||||||||   ||||   |||||| g
3'    ucu    ucu acuguc uucucu cacucgugugcgu   cugu   uauauua 
   aua   -cuc   -      g      u             uua    cau        
Get sequence
Deep sequencing
522 reads, 844 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

Mature sequence nta-miR156c

Accession MIMAT0024631
Sequence

12 - 

ugacagaagagagugagcac

 - 31

Get sequence
Deep sequencing329 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).