Stem-loop sequence nta-MIR156b

AccessionMI0021320
DescriptionNicotiana tabacum miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   --uuaa  ga         -             c      guu   uua      au 
5'       ag  ggugacaga agagagugagcac cauggu   uuc   caugag  a
         ||  ||||||||| ||||||||||||| ||||||   |||   ||||||  u
3'       uc  ccacugucu ucucucacucgug guaucg   aag   guacuu  a
   cuuuug  ac         a             c      ---   uuc      au 
Get sequence
Deep sequencing
367 reads, 633 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence nta-miR156b

Accession MIMAT0024630
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Deep sequencing132 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).