Stem-loop sequence nta-MIR156a

AccessionMI0021319
DescriptionNicotiana tabacum miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ---a    aua         -    -         a     u    ucuugcau 
5'     ugug   ggugacaga agag agugagcac caugg guuu        a
       ||||   ||||||||| |||| ||||||||| ||||| ||||        u
3'     acac   ccacugucu ucuc ucacucgug guauc caag        g
   ucuc    -cc         a    g         c     -    uucauaua 
Get sequence
Deep sequencing
383 reads, 664 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence nta-miR156a

Accession MIMAT0024629
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).