Stem-loop sequence hsa-mir-378j

AccessionMI0021273 (change log)
Symbol HGNC:MIR378J
DescriptionHomo sapiens miR-378j stem-loop
Gene family MIPF0001463; mir-378_2
Literature search

189 open access papers mention hsa-mir-378j
(899 sentences)

Stem-loop
   --------------------------------------a    gugagu        aac     -          a 
5'                                        ugca      cggggagg   uggau uuggagccag a
                                          ||||      ||||||||   ||||| |||||||||| g
3'                                        augu      gucccuuc   aucua aaucuugguc a
   aaccacauauaauugaguauauuaggguuuaggguugag    ------        ---     u          a 
Get sequence
Deep sequencing
5932 reads, 7.53 reads per million, 93 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 37614931-37615039 [-]
intergenic
Database links

Mature sequence hsa-miR-378j

Accession MIMAT0024612
Sequence

21 - 

acuggauuuggagccagaa

 - 39

Get sequence
Deep sequencing5921 reads, 90 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).