Stem-loop sequence lus-MIR396d

AccessionMI0021257 (change log)
DescriptionLinum usitatissimum miR396d stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention lus-MIR396d
(4 sentences)

Stem-loop
   u   uu    agg    -     c        a         ugcuucua   c      g 
5'  ggc  ucug   guau cuucc acagcuuu uugaacugc        cug aucaga a
    |||  ||||   |||| ||||| |||||||| |||||||||        ||| ||||||  
3'  ccg  agac   caua gaagg ugucgaaa aacuugacg        gau uggucu u
   a   --    gaa    a     -        g         ----uacc   u      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lus-miR396d

Accession MIMAT0027237
Sequence

20 - 

ucccacagcuuuauugaacug

 - 40

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).