Stem-loop sequence lus-MIR828a

AccessionMI0021240 (change log)
DescriptionLinum usitatissimum miR828a stem-loop
Gene family MIPF0000544; MIR828
Stem-loop
   guu         ugaau        -    ua      u                 uc  aaacca            gcaguuc   -  uc 
5'    guuaguaga     caccucuu gugg  aacguu cuugcucaaaugagugu  ca      gcaagcgaugga       ugg gu  a
      |||||||||     |||||||| ||||  |||||| |||||||||||||||||  ||      ||||||||||||       ||| ||   
3'    uaguugucu     guggagaa cacu  uuguga gaacggguuuacucgua  gu      cguuuguugucu       acc ca  a
   cuu         -----        a    --      c                 ga  ---cua            -------   u  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lus-miR828a

Accession MIMAT0027220
Sequence

38 - 

ucuugcucaaaugaguguucca

 - 59

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).