Stem-loop sequence lus-MIR156a

AccessionMI0021236
DescriptionLinum usitatissimum miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
         -      -----u               u  g   gg    ---   c            -        a  aa ag    uu    gg 
5' agagag agauaa      gggaggaggaggagg ga gag  ugau   aga ugacagaagaga gugagcac ca  c  gcaa  guau  a
   |||||| ||||||      ||||||||||||||| || |||  ||||   ||| |||||||||||| |||||||| ||  |  ||||  ||||  u
3' ucucuc ucuauu      uccuccuccuccucc cu uuc  guua   ucu acugucuucucu cacucgug gu  g  cguu  caug  g
         c      cuaguu               u  a   ua    aac   -            u        c  gg -g    uc    ag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence lus-miR156a

Accession MIMAT0027216
Sequence

46 - 

ugacagaagagagugagcac

 - 65

Get sequence
Evidence experimental; qRT-PCR [1]

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).