Stem-loop sequence lus-MIR396c

AccessionMI0021233 (change log)
DescriptionLinum usitatissimum miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention lus-MIR396c
(5 sentences)

Stem-loop
      u   c  u    c            c              ua    u       uua 
5' gcc cug uu uauc uuccacagcuuu uugaacugcauaua  uaua augcgaa   g
   ||| ||| || |||| |||||||||||| ||||||||||||||  |||| |||||||    
3' cgg gac aa auag agggugucgaaa aacuuggcgugugu  auau uauguuu   g
      -   u  c    a            u              ua    -       uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lus-miR396c

Accession MIMAT0027213
Sequence

17 - 

uuccacagcuuucuugaacug

 - 37

Get sequence
Evidence experimental; qRT-PCR [1]

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).