Stem-loop sequence lus-MIR156g

AccessionMI0021221
DescriptionLinum usitatissimum miR156g stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   g     -uuguuucu   -u      uga   u     ---   a         -    -                cauu   u    ug 
5'  gaucu         ggg  aagggg   aag aagga   gaa cugacagaa gaga gugagcacuuagagac    aug uaua  a
    |||||         |||  ||||||   ||| |||||   ||| ||||||||| |||| ||||||||||||||||    ||| ||||   
3'  uuaga         ucu  uucuuc   uuc uuccu   cuu ggcugucuu cucu cacucguggauuuuug    uac auau  a
   u     uuuuguucu   uc      uuc   -     acu   c         u    u                ---u   c    cu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence lus-miR156g

Accession MIMAT0027201
Sequence

42 - 

ugacagaagagagugagcac

 - 61

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).