Stem-loop sequence lus-MIR156f

AccessionMI0021206
DescriptionLinum usitatissimum miR156f stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
           -  cu u    gg -    uugu         -              u  --       caauuga 
5' ggguugag ag  c uuug  g gaug    ugacagaag auagagagcacaga ga  ugggaua       u
   |||||||| ||  | ||||  | ||||    ||||||||| |||||||||||||| ||  |||||||        
3' ccuagcuc uc  g gagc  u cuac    acugucuuc uaucucucguguuu cu  acucuau       a
           c  cg c    uu u    ---u         g              c  uc       acauaug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence lus-miR156f

Accession MIMAT0027186
Sequence

29 - 

uugacagaagauagagagcac

 - 49

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).