Stem-loop sequence lus-MIR156e

AccessionMI0021204
DescriptionLinum usitatissimum miR156e stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
          ua   au   -   u u         -    a         u  ---   a     gua 
5' ggaagga  agg  ugu ugu g ugacagaag auag gagcacaga ga   uga auacu   g
   |||||||  |||  ||| ||| | ||||||||| |||| ||||||||| ||   ||| |||||    
3' cuuuccu  ucc  acg aca c acugucuuc uauc cucguguuu cu   acu uauga   u
          --   --   u   - u         g    c         c  uuc   c     aag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence lus-miR156e

Accession MIMAT0027184
Sequence

23 - 

uugacagaagauagagagcac

 - 43

Get sequence
Evidence not experimental

References

1
PMID:23291876 "Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes" Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY Planta. 237:1149-1161(2013).